All Repeats of Pyrophorus divergens mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_009964 | (ATAA)3 | p4 | 13278 | 13289 | 12 | Design Primer |
| 2 | NC_009964 | (AATT)3 | p4 | 14390 | 14401 | 12 | Design Primer |
| 3 | NC_009964 | (T)12 | p1 | 15280 | 15291 | 12 | Design Primer |
| 4 | NC_009964 | (AAT)4gattaatcacttacaatgatttatatatatttcttatttttactaataaaacact(TA)7 | c | 15426 | 15506 | 81 | Design Primer |
| 5 | NC_009964 | (AT)6 | p2 | 15655 | 15666 | 12 | Design Primer |
| 6 | NC_009964 | (A)17 | p1 | 15881 | 15897 | 17 | Design Primer |