Compound Repeats of Pleurotus ostreatus mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_009905 | (T)15aattttttttctcttgatattaaaaataaactaaaactctttaagtgaaaattttta(T)12 | c | 3812 | 3895 | 84 | Design Primer |
2 | NC_009905 | (A)12ttattact(A)10 | c | 15926 | 15955 | 30 | Design Primer |
3 | NC_009905 | (AATA)3cttaccttctgttgt(A)10 | c | 44881 | 44917 | 37 | Design Primer |
4 | NC_009905 | (AAAATA)3aaaaataa(AAAT)5 | c | 49629 | 49674 | 46 | Design Primer |