Compound Repeats of Cuscuta reflexa chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_009766 | (A)12tttacagattaagcgattttttg(TTACCT)3 | c | 101790 | 101842 | 53 | Design Primer |
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_009766 | (A)12tttacagattaagcgattttttg(TTACCT)3 | c | 101790 | 101842 | 53 | Design Primer |