Compound Compound Repeats of Vampyroteuthis infernalis mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_009689 | (A)12ttaaaataattaaacacaaaacacatacaacttccaaaaaa(TATTT)3 | c | 8602 | 8669 | 68 | Design Primer |
2 | NC_009689 | (AAAT)3ctttttacttcgagataaactt(AATATA)3 | c | 13225 | 13276 | 52 | Design Primer |
3 | NC_009689 | (TAT)4a(AAAT)3atatatttatttatatagttgtaa(AT)6 | c | 15547 | 15607 | 61 | Design Primer |