All Repeats of Vampyroteuthis infernalis mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_009689 | (ATTTTA)3 | p6 | 4181 | 4198 | 18 | Design Primer |
2 | NC_009689 | (TAT)4 | p3 | 6633 | 6644 | 12 | Design Primer |
3 | NC_009689 | (AT)6 | p2 | 8377 | 8388 | 12 | Design Primer |
4 | NC_009689 | (A)12ttaaaataattaaacacaaaacacatacaacttccaaaaaa(TATTT)3 | c | 8602 | 8669 | 68 | Design Primer |
5 | NC_009689 | (A)15 | p1 | 10719 | 10733 | 15 | Design Primer |
6 | NC_009689 | (AAAT)3ctttttacttcgagataaactt(AATATA)3 | c | 13225 | 13276 | 52 | Design Primer |
7 | NC_009689 | (AT)7 | p2 | 15430 | 15443 | 14 | Design Primer |
8 | NC_009689 | (TAT)4a(AAAT)3atatatttatttatatagttgtaa(AT)6 | c | 15547 | 15607 | 61 | Design Primer |