Compound Compound Repeats of Dioscorea elephantipes chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_009601 | (TTTA)3tttgattttcgttaataaaatacgccttgtcttctataattagagagtaaatccgtcaaaccatcacatcatttggctgaactgaaggaaaacc(CAAT)3 | c | 4212 | 4329 | 118 | Design Primer |
| 2 | NC_009601 | (TTA)5tttattttaatatttttgaatgaaat(A)13 | c | 11584 | 11637 | 54 | Design Primer |
| 3 | NC_009601 | (T)15atttggatggttcatgaatgaaccta(AT)8 | c | 30896 | 30952 | 57 | Design Primer |
| 4 | NC_009601 | (A)12ttgcgaaaaaagaatcaatgtaccgattccagttccatttctttttttttgtaacaggttttaacatgaaatgaaaggatttgtttttcttc(A)14 | c | 69690 | 69807 | 118 | Design Primer |