Compound Compound Repeats of Olimarabidopsis pumila chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_009267 | (TAAA)3acataaccttaattaatagaatataacagtatattcactttctaattttgatttcattagtttctaaataagaaaatcttaattagatcagaaatc(T)14 | c | 46057 | 46178 | 122 | Design Primer |
| 2 | NC_009267 | (T)13atttcaatttgaattttgatgaaatac(TAAA)4 | c | 62866 | 62921 | 56 | Design Primer |
| 3 | NC_009267 | (A)12gaatcaaaccac(T)12 | c | 65016 | 65051 | 36 | Design Primer |