Compound Repeats of Angiopteris evecta chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_008829 | (A)13ttattgagaacaatattcaaa(AT)6 | c | 114073 | 114118 | 46 | Design Primer |
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_008829 | (A)13ttattgagaacaatattcaaa(AT)6 | c | 114073 | 114118 | 46 | Design Primer |