Compound Compound Repeats of Heterorhabditis bacteriophora mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_008534 | (AT)7aatatatattataatatatattataatatatattatatatattataataataat(TA)28tttatataa(AT)56agattataca(AT)6acgtag(TA)6 | c | 16762 | 17046 | 285 | Design Primer |
2 | NC_008534 | (AT)27gttatatataatat(TA)6atatatattagctataatatatat(TA)8 | c | 17212 | 17331 | 120 | Design Primer |
3 | NC_008534 | (AT)7aatttatt(TA)7 | c | 17509 | 17544 | 36 | Design Primer |