Compound Compound Repeats of Morus indica chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_008359 | (TTTCT)3ttctaaacgaaaaggaatggttaatttcacataaagaaataagtcttttttttttcacgaggtataacgataaacc(TATT)3 | c | 24084 | 24186 | 103 | Design Primer |
2 | NC_008359 | (A)12ggtttacaagatttataaatagaattctca(T)12 | c | 53591 | 53644 | 54 | Design Primer |
3 | NC_008359 | (AAT)4gctattca(T)13 | c | 127895 | 127927 | 33 | Design Primer |