Compound Repeats of Citrus sinensis chloroplast
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_008334 | (AAAT)4(A)12 | c | 10615 | 10642 | 28 | Design Primer |
| 2 | NC_008334 | (T)16ctatcccgaattg(TCTT)3 | c | 47636 | 47676 | 41 | Design Primer |
| 3 | NC_008334 | (A)13tagaccgatccgttgattcgttccaactcattgattaaatcaggtagaaatatcag(A)15 | c | 47956 | 48039 | 84 | Design Primer |
| 4 | NC_008334 | (AAAT)3(A)12gtcc(T)12 | c | 118310 | 118349 | 40 | Design Primer |