Compound Compound Repeats of Populus alba chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_008235 | (A)16gaaaatttattttaggagcaatgccaaccctcttgatagaacaagaaattggcgattgctcc(T)12 | c | 185 | 274 | 90 | Design Primer |
2 | NC_008235 | (TAT)4attactcttaatatattagtattctaattagtattatttagtattattagtattatttagtattatagtaatttactatattaattact(ATTA)4 | c | 7023 | 7139 | 117 | Design Primer |
3 | NC_008235 | (T)14g(A)12 | c | 10381 | 10407 | 27 | Design Primer |
4 | NC_008235 | (A)18ggattcgcaccgaacagaagagata(T)15 | c | 26201 | 26258 | 58 | Design Primer |
5 | NC_008235 | (TAA)4ttaataatat(TAA)4 | c | 42723 | 42756 | 34 | Design Primer |
6 | NC_008235 | (A)12tgaattctttcttgtttatgattcattgactcttatctctttttaatttttaaagaatcagtcaatc(A)13 | c | 114678 | 114769 | 92 | Design Primer |