Compound Repeats of Triticum aestivum mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_007579 | (AGAAT)4aaacacatggcacagctgggtgctagaatagtagttgatagaagttctagtcactt(A)10 | c | 48692 | 48777 | 86 | Design Primer |
| 2 | NC_007579 | (AG)8cagatggatcctatcccctataacgaacactcattcctatctattgatagaaaagaaagatcttcgtcacggactttttctttgttca(T)11 | c | 208813 | 208927 | 115 | Design Primer |
| 3 | NC_007579 | (CATT)3(TCAT)3 | c | 259325 | 259348 | 24 | Design Primer |
| 4 | NC_007579 | (CATT)3(TCAT)3 | c | 371063 | 371086 | 24 | Design Primer |