Compound Repeats of Candida metapsilosis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_006971 | (TA)6ca(TATAT)3tctcatctatttattttta(TTAT)3 | c | 142 | 201 | 60 | Design Primer |
| 2 | NC_006971 | (TA)6ca(TATAT)3tctcatctatttattttta(TTAT)3 | c | 762 | 821 | 60 | Design Primer |
| 3 | NC_006971 | (TAT)5cattacctgtattaacagctggtattac(ATT)4 | c | 10493 | 10547 | 55 | Design Primer |
| 4 | NC_006971 | (AT)6tctttt(TA)6 | c | 18539 | 18568 | 30 | Design Primer |
| 5 | NC_006971 | (AATA)3ataaaaataaatagatgag(AATAT)3atg(TA)6 | c | 23331 | 23391 | 61 | Design Primer |
| 6 | NC_006971 | (AATA)3ataaaaataaatagatgag(AATAT)3atg(TA)6 | c | 23951 | 24011 | 61 | Design Primer |