Compound Compound Repeats of Kluyveromyces thermotolerans mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_006626 | (C)13agctaagct(G)12 | c | 542 | 575 | 34 | Design Primer |
| 2 | NC_006626 | (AT)6tatataataaatccttctctttcctcctttcgatggggttcctttaataaatgagtagggacaaatctaaaagatata(AT)10 | c | 5987 | 6096 | 110 | Design Primer |
| 3 | NC_006626 | (C)11atgcttcgcat(G)11tataagtatggacaatccgcaggaaaccaaataataattaatatcctaaacaaagtaagtgaaggagatatcttaaaatatatata(AT)9 | c | 9967 | 10103 | 137 | Design Primer |
| 4 | NC_006626 | (C)11tccagatatacaggga(G)14 | c | 20293 | 20333 | 41 | Design Primer |
| 5 | NC_006626 | (C)12agcttagct(G)15 | c | 23543 | 23578 | 36 | Design Primer |