All Repeats of Neomaskellia andropogonis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_006159 | (T)19attaatttttatttatatgattatg(T)16 | c | 2627 | 2686 | 60 | Design Primer |
| 2 | NC_006159 | (T)19 | p1 | 3107 | 3125 | 19 | Design Primer |
| 3 | NC_006159 | (T)13 | p1 | 3643 | 3655 | 13 | Design Primer |
| 4 | NC_006159 | (TTA)4 | p3 | 3839 | 3850 | 12 | Design Primer |
| 5 | NC_006159 | (AAT)4 | p3 | 6458 | 6469 | 12 | Design Primer |
| 6 | NC_006159 | (T)16 | p1 | 7123 | 7138 | 16 | Design Primer |
| 7 | NC_006159 | (TTAT)3ttttaatgttttattattaatttgagtaggtgctaatcaagttgagtttccatttttaattattggtcagtttaggacactttattttta(T)12 | c | 8213 | 8326 | 114 | Design Primer |
| 8 | NC_006159 | (ATT)4 | p3 | 8467 | 8478 | 12 | Design Primer |
| 9 | NC_006159 | (A)12 | p1 | 9028 | 9039 | 12 | Design Primer |
| 10 | NC_006159 | (AT)6 | p2 | 12090 | 12101 | 12 | Design Primer |
| 11 | NC_006159 | (TAA)4(A)14* | c* | 12227 | 12250 | 24 | Design Primer |
| 12 | NC_006159 | (T)15 | p1 | 14410 | 14424 | 15 | Design Primer |