All Repeats of Pelodiscus sinensis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_006132 | (AATC)3 | p4 | 9162 | 9173 | 12 | Design Primer |
| 2 | NC_006132 | (ACCC)3 | p4 | 14016 | 14027 | 12 | Design Primer |
| 3 | NC_006132 | (TAAT)3gcttgacggacataaaatttataaaaaactcacgacactaaattacgc(GCACAT)20(ACACAT)14(GCACAT)9(CCTTCC)4ccatcccctgcacaatgacaagcaccatcacctgcaccagcaccagcacaatcaccttg(CCCTTC)6 | c | 16493 | 16929 | 437 | Design Primer |