All Repeats of Steinernema carpocapsae mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_005941 | (T)13c(T)12agttttatttctattaatatttattgttggggtgggc(T)14 | c | 7195 | 7271 | 77 | Design Primer |
2 | NC_005941 | (T)13 | p1 | 8189 | 8201 | 13 | Design Primer |
3 | NC_005941 | (T)12 | p1 | 11174 | 11185 | 12 | Design Primer |
4 | NC_005941 | (T)13cttatattttttcttatattttttaattttaaattgtcc(T)12 | c | 12319 | 12382 | 64 | Design Primer |
5 | NC_005941 | (ATT)4 | p3 | 12513 | 12524 | 12 | Design Primer |
6 | NC_005941 | (TTTCT)3 | p5 | 13771 | 13785 | 15 | Design Primer |