Compound Repeats of Chlamydomonas reinhardtii chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_005353 | (TTAAA)3(TTAAT)3 | c | 35501 | 35530 | 30 | Design Primer |
2 | NC_005353 | (AATTA)3(ATTTA)3 | c | 158672 | 158701 | 30 | Design Primer |
3 | NC_005353 | (TTC)4atcggtcacttatggcacgcaggtcgtgcacg(TGC)4tggtttcgaaaaaggtatcgaccgtttcgacgaaccagttctttcaatgcgtcctttagactaattt(TTA)4 | c | 188291 | 188425 | 135 | Design Primer |