All Repeats of Parazen pacificus mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_004396 | (AAAT)3 | p4 | 1691 | 1702 | 12 | Design Primer |
| 2 | NC_004396 | (CAAC)3 | p4 | 8421 | 8432 | 12 | Design Primer |
| 3 | NC_004396 | (TTA)4cccgctgaggcaaccagaaagaacgactaaatgcaggtacctattttttattttatacccttgcgggatcattaccattactagtggc(CCT)4 | c | 10704 | 10815 | 112 | Design Primer |