All Repeats of Thrips imaginis mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_004371 | (A)12tataaac(A)13 | c | 32 | 63 | 32 | Design Primer |
| 2 | NC_004371 | (A)12taaaacctaat(A)13 | c | 1627 | 1662 | 36 | Design Primer |
| 3 | NC_004371 | (A)17 | p1 | 2734 | 2750 | 17 | Design Primer |
| 4 | NC_004371 | (A)12 | p1 | 3201 | 3212 | 12 | Design Primer |
| 5 | NC_004371 | (A)13 | p1 | 3314 | 3326 | 13 | Design Primer |
| 6 | NC_004371 | (AAAT)3 | p4 | 3702 | 3713 | 12 | Design Primer |
| 7 | NC_004371 | (AATT)3 | p4 | 4989 | 5000 | 12 | Design Primer |
| 8 | NC_004371 | (T)20ataaattcatcgatatatattaccccgaatttattttt(TA)8 | c | 9330 | 9403 | 74 | Design Primer |
| 9 | NC_004371 | (T)18ataaattcatcgatatatattaccacgaatttattttt(TA)7 | c | 15263 | 15332 | 70 | Design Primer |