Compound Compound Repeats of Medicago truncatula chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_003119 | (ATTA)4taagtaatataaataactatgtttgtcatt(TA)7 | c | 2668 | 2727 | 60 | Design Primer |
2 | NC_003119 | (AT)6aaatttatatt(TA)6 | c | 13281 | 13315 | 35 | Design Primer |
3 | NC_003119 | (AAT)4agatg(A)12 | c | 45305 | 45333 | 29 | Design Primer |
4 | NC_003119 | (T)13cgaacttattctagtctaattag(A)16 | c | 59503 | 59554 | 52 | Design Primer |
5 | NC_003119 | (TAA)4ttaattaactaa(TAAT)3 | c | 75724 | 75759 | 36 | Design Primer |
6 | NC_003119 | (AAT)4tttaagataagaattttaattaagag(TTAA)3 | c | 109596 | 109645 | 50 | Design Primer |
7 | NC_003119 | (GAAT)3taaatagaaataagttagatt(A)12ttagaatagaaatatttttatatttgttttctctattgta(T)14 | c | 119283 | 119381 | 99 | Design Primer |