Compound Compound Repeats of Lotus japonicus chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_002694 | (AT)11tac(AT)6agaaatatataaatc(T)12 | c | 14652 | 14715 | 64 | Design Primer |
2 | NC_002694 | (TTA)5tatctatt(TTA)4 | c | 15043 | 15077 | 35 | Design Primer |
3 | NC_002694 | (ATA)5cttatagtttaggg(ATA)4cttatagtttagggataatttactcag(A)12 | c | 24438 | 24517 | 80 | Design Primer |
4 | NC_002694 | (T)12acttcacaaacaaaacaaacgggcatgttggatcatg(TA)8 | c | 25535 | 25599 | 65 | Design Primer |
5 | NC_002694 | (A)13tgaatggcccgattatgtgtcaacggtcaattttcggtagaagagaaggttccatcggaacaattttctatttctatttcaggataccaggtccc(T)12caa(T)12c(A)13 | c | 44795 | 44943 | 149 | Design Primer |
6 | NC_002694 | (TA)6ttaactagt(TA)7 | c | 46858 | 46892 | 35 | Design Primer |
7 | NC_002694 | (TA)6atatatataataaacattcaaaattttacttc(T)13 | c | 60451 | 60507 | 57 | Design Primer |
8 | NC_002694 | (T)12gtgagaatatttttgaaatactatggtggttccgttgctttcttattttgtctcatttgttattcagcaatccaaaagtttc(T)12 | c | 68017 | 68122 | 106 | Design Primer |