Compound Repeats of Oenothera elata subsp. hookeri plastid plastome I
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_002693 | (CCAT)3attgtacatatattaatatactccaacatattagaatatggaatgggtagattagaatatggcaacatattatatgtcaacatattctaatctac(CCAT)3 | c | 6513 | 6631 | 119 | Design Primer |
| 2 | NC_002693 | (T)13gg(A)13 | c | 58843 | 58870 | 28 | Design Primer |
| 3 | NC_002693 | (GAGGAA)7gaggatgagcttcac(GAGGAA)4 | c | 98566 | 98646 | 81 | Design Primer |
| 4 | NC_002693 | (ACG)4attagctcgttggtattggtaggatccccttttggacgttgggagcggatgacataggagcgggccccagcgggagtcccgcacgacgacgac(ACG)4 | c | 108890 | 109006 | 117 | Design Primer |
| 5 | NC_002693 | (A)12ggattttcgttttggttgaaattttgataattattaactaattcatcagcgagctgcttgagtttc(T)13 | c | 118485 | 118575 | 91 | Design Primer |
| 6 | NC_002693 | (CATTTT)3gaataacattttgccttccatcttcaatagga(TCATTT)3 | c | 130564 | 130631 | 68 | Design Primer |
| 7 | NC_002693 | (TCG)4tgtcgtcgtcgtgcgggactcccgctggggcccgctcctatgtcatccgctcccaacgtccaaaaggggatcctaccaataccaacgagctaa(TCG)4 | c | 146064 | 146180 | 117 | Design Primer |
| 8 | NC_002693 | (TCCTCT)4tcctcgtgaagctca(TCCTCT)7 | c | 156420 | 156500 | 81 | Design Primer |