Compound Compound Repeats of Mesostigma viride chloroplast
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_002186 | (TAA)6(TAT)4 | c | 65569 | 65598 | 30 | Design Primer |
2 | NC_002186 | (TTTCA)3t(TTTAG)3at(TGAAA)4 | c | 75403 | 75455 | 53 | Design Primer |
3 | NC_002186 | (TAAA)3aaatatctatgcaattacaacaataatatataatcaattctaataaa(TATAG)3 | c | 102841 | 102914 | 74 | Design Primer |
4 | NC_002186 | (TAA)5aatttttataggaaaatttatggaataattttgtattttcgaatccaataattgaaagatattagtaaaaaatagagtcaatctagtatttgacata(ATT)4tttattataaattcgctgaattgattattttattttaggct(ATAAA)3 | c | 104289 | 104468 | 180 | Design Primer |