All Repeats of Ornithorhynchus anatinus mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_000891 | (TAT)4 | p3 | 3496 | 3507 | 12 | Design Primer |
| 2 | NC_000891 | (ATT)4 | p3 | 10966 | 10977 | 12 | Design Primer |
| 3 | NC_000891 | (AT)6 | p2 | 15564 | 15575 | 12 | Design Primer |
| 4 | NC_000891 | (T)17caggttttttttgccttttcaccttatatgtcatataatctggga(C)12 | c | 16896 | 16969 | 74 | Design Primer |