Compound Compound Repeats of Botryllus schlosseri complete mitochondrial genome
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_021463 | (TTTC)3tttgttgaa(T)11 | c | 2196 | 2227 | 32 | Design Primer |
2 | NC_021463 | (T)12atttttcttaagtagttttattattttg(T)11 | c | 2443 | 2493 | 51 | Design Primer |
3 | NC_021463 | (T)10aagttttgttagatttaatttagattttttcttggaatttaatttatggttcaattatagatttttattgacttttgatgtttattctacta(T)14 | c | 2601 | 2716 | 116 | Design Primer |
4 | NC_021463 | (T)11gttattttttacttaattgttacttgctataagaaactaaatctcaatagtattgttta(TTAT)3 | c | 5384 | 5465 | 82 | Design Primer |
5 | NC_021463 | (T)10ctctattg(T)11 | c | 7735 | 7763 | 29 | Design Primer |
6 | NC_021463 | (T)11c(T)13 | c | 9855 | 9879 | 25 | Design Primer |
7 | NC_021463 | (T)13aaaaagtagagaag(T)11 | c | 10609 | 10646 | 38 | Design Primer |