All Repeats of Hipposideros armiger mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_018540 | (ACC)4 | p3 | 4553 | 4564 | 12 | Design Primer |
| 2 | NC_018540 | (CCTC)3 | p4 | 11455 | 11466 | 12 | Design Primer |
| 3 | NC_018540 | (ATAC)3 | p4 | 15557 | 15568 | 12 | Design Primer |
| 4 | NC_018540 | (ACGCAT)3acg(ACGCAT)10acgcacacgcacacgcatacgcatacg(ACCCAT)3 | c | 16315 | 16440 | 126 | Design Primer |