Compound Repeats of Beta macrocarpa mitochondrion
Click on Table Heading To Sort Results Accordingly
| S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
|---|---|---|---|---|---|---|---|
| 1 | NC_015994 | (TTGT)3aacgaattcattgaa(T)10 | c | 51307 | 51343 | 37 | Design Primer |
| 2 | NC_015994 | (AAGT)3caagtcattgaataaagtctttc(T)10 | c | 60525 | 60569 | 45 | Design Primer |
| 3 | NC_015994 | (CGCC)3accaactggcacgctagcctcccatcgactagggccaagacaagtagaggagcgaggtacgag(CTT)4 | c | 224891 | 224977 | 87 | Design Primer |
| 4 | NC_015994 | (TGAG)3cgctttttctgct(ATGA)3 | c | 383831 | 383867 | 37 | Design Primer |