Compound Compound Repeats of Beta vulgaris subsp. maritima mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_015099 | (TTGT)3aacgaattcattgaa(T)10 | c | 61686 | 61722 | 37 | Design Primer |
2 | NC_015099 | (AAGT)3caagtcattgaataaagtctttc(T)10 | c | 70904 | 70948 | 45 | Design Primer |
3 | NC_015099 | (TGAG)3cgctttttctgct(ATGA)3 | c | 125067 | 125103 | 37 | Design Primer |
4 | NC_015099 | (CGCC)3accaactggcacgctagcctcccatcgactagggccaagacaagtagaggagcgaggtacgag(CTT)4 | c | 224975 | 225061 | 87 | Design Primer |