Compound Compound Repeats of Zea mays subsp. parviglumis mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_008332 | (CTCTA)4ct(AAATG)4 | c | 4498 | 4539 | 42 | Design Primer |
2 | NC_008332 | (TTCTA)3tcttgataaaactatgtaaacgataagtaagcttacggcataacttcttgtattccgatagctgg(CTTA)3 | c | 66015 | 66106 | 92 | Design Primer |
3 | NC_008332 | (CTCTA)4ct(AAATG)4 | c | 93396 | 93437 | 42 | Design Primer |
4 | NC_008332 | (TATTAC)5t(ATGGAA)3 | c | 131158 | 131206 | 49 | Design Primer |
5 | NC_008332 | (TGAG)3tccactgtttacgttacaactagcagtagcgtgtcaattctagtcagaaaaaaagctttccattgattcatgata(GTGCC)3 | c | 155989 | 156090 | 102 | Design Primer |
6 | NC_008332 | (T)10agttcgcactgctctttctctctaaattgcatcaaagaaaat(AG)6 | c | 204410 | 204473 | 64 | Design Primer |
7 | NC_008332 | (CTC)4gttgttgccgtggagaaagaccgtattcacgtctagttgaaatagatgcaagtcctcggccgc(TACTA)4 | c | 299603 | 299697 | 95 | Design Primer |
8 | NC_008332 | (ATAGA)3taggtatctctgtggatagagataaagatagggatccctcgaaatatatggaaaaagtgcactttttg(ACT)4 | c | 322045 | 322139 | 95 | Design Primer |
9 | NC_008332 | (ATA)5tatattatatcttta(TAT)4 | c | 331462 | 331503 | 42 | Design Primer |
10 | NC_008332 | (TTAGT)4(ATAGT)5 | c | 405114 | 405158 | 45 | Design Primer |
11 | NC_008332 | (CTC)4gttgttgccgtggagaaagaccgtattcacgtctagttgaaatagatgcaagtcctcggccgc(TACTA)4 | c | 446256 | 446350 | 95 | Design Primer |
12 | NC_008332 | (ATAGA)3taggtatctctgtggatagagataaagatagggatccctcgaaatatatggaaaaagtgcactttttg(ACT)4 | c | 468698 | 468792 | 95 | Design Primer |
13 | NC_008332 | (ATA)5tatattatatcttta(TAT)4 | c | 478115 | 478156 | 42 | Design Primer |
14 | NC_008332 | (TACTA)6(AACTA)3 | c | 558331 | 558375 | 45 | Design Primer |
15 | NC_008332 | (GAAA)3attcccatgtgaaatttcactttcactttaacaataacaatgcctgcttttttaatgttataaacttagaccaaaaaaataaccataccataagccgtat(AACA)3 | c | 559987 | 560110 | 124 | Design Primer |
16 | NC_008332 | (TAAGTG)3aacgaaatgctga(TTGC)3 | c | 636502 | 636544 | 43 | Design Primer |
17 | NC_008332 | (TACTA)3taacgcacacgtttcattattgttgctttactat(ATATG)3 | c | 656311 | 656374 | 64 | Design Primer |