Compound Compound Repeats of Zea mays subsp. mays mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_007982 | (ATAGA)3taggtatctctgtggatagagataaagatagggatccctcgaaatatatggaaaaagtgcacttttt(TAC)4 | c | 20981 | 21074 | 94 | Design Primer |
2 | NC_007982 | (CT)6attttctttgatgcaatttagagagaaagagcagtgcgaact(A)10 | c | 112502 | 112565 | 64 | Design Primer |
3 | NC_007982 | (TATTAC)4t(ATGGAA)4 | c | 285759 | 285807 | 49 | Design Primer |
4 | NC_007982 | (GCAA)3tcagcatttcgtt(CACTTA)3 | c | 316082 | 316124 | 43 | Design Primer |
5 | NC_007982 | (TTAGT)4(ATAGT)5 | c | 381977 | 382021 | 45 | Design Primer |
6 | NC_007982 | (CCTTC)3cc(TTATAG)3 | c | 425142 | 425176 | 35 | Design Primer |
7 | NC_007982 | (TGAG)3tccactgtttacgttacaactagcagtagcgtgtcaattctagtcagaaaaaaagctttccattgattcatgata(GTGCC)3 | c | 462915 | 463016 | 102 | Design Primer |
8 | NC_007982 | (CTC)4gttgttgccgtggagaaagaccgtattcacgtctagttgaaatagatgcaagtcctcggccgc(TACTA)5 | c | 484968 | 485067 | 100 | Design Primer |
9 | NC_007982 | (TACTA)4taacgcacacgtttcattattgttgctttactat(ATATG)3 | c | 502973 | 503041 | 69 | Design Primer |
10 | NC_007982 | (TGAG)3tccactgtttacgttacaactagcagtagcgtgtcaattctagtcagaaaaaaagctttccattgattcatgata(GTGCC)3 | c | 531852 | 531953 | 102 | Design Primer |
11 | NC_007982 | (ATA)5tatattatatcttta(TAT)4 | c | 550196 | 550237 | 42 | Design Primer |