Compound Compound Repeats of Beta vulgaris subsp. vulgaris mitochondrion
Click on Table Heading To Sort Results Accordingly
S.No. | Genome ID | SSR | SSR Type | Start | End | Tract Length | Primer Design |
---|---|---|---|---|---|---|---|
1 | NC_002511 | (AAGT)3caagtcattgaataaagtctttc(T)10 | c | 141011 | 141055 | 45 | Design Primer |
2 | NC_002511 | (TGAG)3cgctttttctgct(ATGA)3 | c | 195121 | 195157 | 37 | Design Primer |
3 | NC_002511 | (TTGT)3aacgaattcattgaa(T)10 | c | 249880 | 249916 | 37 | Design Primer |
4 | NC_002511 | (CGCC)3accaactggcacgctagcctcccatcgactagggccaagacaagtagaggagcgaggtacgag(CTT)4 | c | 309099 | 309185 | 87 | Design Primer |